rbl2

Ensembl ID:
ENSDARG00000045636
Human Orthologue:
RBL2
Human Description:
retinoblastoma-like 2 (p130) [Source:HGNC Symbol;Acc:9894]
Mouse Orthologue:
Rbl2
Mouse Description:
retinoblastoma-like 2 Gene [Source:MGI Symbol;Acc:MGI:105085]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14836 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073432 Essential Splice Site 615 1079 14 22
Genomic Location (Zv9):
Chromosome 25 (position 37109382)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35516998
KASP Assay ID:
1641-0496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCAAGACTGAATTCAGCGGCAACATCGCAGCGGGAGCAGGAAAAGG[T/C]GATTTACAGTACTTGMAKGCGAACTGAACGCAAGWTAATATCTAWRAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link