LOC571601

Ensembl ID:
ENSDARG00000045632
Human Orthologue:
BMP10
Human Description:
bone morphogenetic protein 10 [Source:HGNC Symbol;Acc:20869]
Mouse Orthologue:
Bmp10
Mouse Description:
bone morphogenetic protein 10 Gene [Source:MGI Symbol;Acc:MGI:1338820]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11654 Nonsense Available for shipment Available now
sa5823 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067102 Nonsense 154 380 3 3
Genomic Location:
Chromosome 10 (position 568474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAWCGCAAGGACATCAGCTGGGAAGTGTTTGACATGACCAACGCCATC[C/T]GAAACTGGAGAAAAGTCGGCAYYGAGACCCCAAACCTGGAGGYGTGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067102 Nonsense 323 380 3 3
Genomic Location:
Chromosome 10 (position 568981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTCGCGGCGTCTGCAGCTRTCCTCTGACTCAAAAAGTGACGCCGACT[A/T]AACACGCCATCGTCCAGACGCTGCTCAATCTGAAGAGTCCCCAACGGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/50u7tk53