cyp3a65

Ensembl ID:
ENSDARG00000045627
ZFIN ID:
ZDB-GENE-050604-1
Description:
cytochrome P450, family 3, subfamily A, polypeptide 65 [Source:RefSeq peptide;Acc:NP_001032515]
Human Orthologues:
CYP3A4, CYP3A43, CYP3A5, CYP3A7
Human Descriptions:
cytochrome P450, family 3, subfamily A, polypeptide 4 [Source:HGNC Symbol;Acc:2637]
cytochrome P450, family 3, subfamily A, polypeptide 43 [Source:HGNC Symbol;Acc:17450]
cytochrome P450, family 3, subfamily A, polypeptide 5 [Source:HGNC Symbol;Acc:2638]
cytochrome P450, family 3, subfamily A, polypeptide 7 [Source:HGNC Symbol;Acc:2640]
Mouse Orthologues:
Cyp3a11, Cyp3a13, Cyp3a16, Cyp3a25, Cyp3a41a, Cyp3a41b, Cyp3a44, Cyp3a57, Cyp3a59
Mouse Descriptions:
cytochrome P450, family 3, subfamily a, polypeptide 11 Gene [Source:MGI Symbol;Acc:MGI:88609]
cytochrome P450, family 3, subfamily a, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:88610]
cytochrome P450, family 3, subfamily a, polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:106099]
cytochrome P450, family 3, subfamily a, polypeptide 25 Gene [Source:MGI Symbol;Acc:MGI:1930638]
cytochrome P450, family 3, subfamily a, polypeptide 41A Gene [Source:MGI Symbol;Acc:MGI:1858451]
cytochrome P450, family 3, subfamily a, polypeptide 41B Gene [Source:MGI Symbol;Acc:MGI:3714859]
cytochrome P450, family 3, subfamily a, polypeptide 44 Gene [Source:MGI Symbol;Acc:MGI:2449818]
cytochrome P450, family 3, subfamily a, polypeptide 57 Pseudogene [Source:MGI Symbol;Acc:MGI:3646373
cytochrome P450, subfamily 3A, polypeptide 59 Gene [Source:MGI Symbol;Acc:MGI:3769707]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9780 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113943 Nonsense 406 518 11 13
Genomic Location:
Chromosome 1 (position 60215122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAACGGCCTCCTCATYCCCAAAGACTTGGTGGTCATGGTGCCGACCTA[C/A]GCCCTCCACAGAGACCCCGATTACTGGAGCGAACCGGAGAGCTTCAAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3gpey2z5