nek8

Ensembl ID:
ENSDARG00000045626
ZFIN ID:
ZDB-GENE-020509-1
Description:
Serine/threonine-protein kinase Nek8 [Source:UniProtKB/Swiss-Prot;Acc:Q90XC2]
Human Orthologue:
NEK8
Human Description:
NIMA (never in mitosis gene a)- related kinase 8 [Source:HGNC Symbol;Acc:13387]
Mouse Orthologue:
Nek8
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 8 Gene [Source:MGI Symbol;Acc:MGI:1890646]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42510 Nonsense Mutation detected in F1 DNA During 2017
sa35832 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067095 Nonsense 382 697 8 15
Genomic Location (Zv9):
Chromosome 15 (position 14507404)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15552367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCGCCCTCGGTTGGATCCGGTGAGCCCACTCTGCCTGGCGCTGTTGAG[C/T]AGATGCAGCCCCAGTTCATCTCCCGCTTCCTAGAGGGCCAGTCTGGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067095 Nonsense 423 697 9 15
Genomic Location (Zv9):
Chromosome 15 (position 14511653)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15556616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAATTTGCTTTGGGTTGTTTTGCAGATAGAGGTATAATCATGACGTTT[G/T]GAAGTGGAAGCAATGGTTGTCTTGGACATGGGAACTTTAATGATGTGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link