clta

Ensembl ID:
ENSDARG00000045618
ZFIN ID:
ZDB-GENE-040426-1986
Description:
clathrin light chain A [Source:RefSeq peptide;Acc:NP_998210]
Human Orthologue:
CLTA
Human Description:
clathrin, light chain A [Source:HGNC Symbol;Acc:2090]
Mouse Orthologue:
Clta
Mouse Description:
clathrin, light polypeptide (Lca) Gene [Source:MGI Symbol;Acc:MGI:894297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32617 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067082 Essential Splice Site 63 235 None 7
ENSDART00000138759 Essential Splice Site 63 223 None 6
ENSDART00000144920 Essential Splice Site 63 205 None 5

The following transcripts of ENSDARG00000045618 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 11644639)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11661708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTGGACAGCGGAGATGTGCCTTCGTCCCTGAGCCAAGACCAGGACGG[T/A]GGGTTTACACGACATATTATTTGCACCACATCGATGATAAAGATTAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link