lrrc10

Ensembl ID:
ENSDARG00000045612
ZFIN ID:
ZDB-GENE-071119-6
Description:
leucine-rich repeat-containing protein 10 [Source:RefSeq peptide;Acc:NP_001009559]
Human Orthologue:
LRRC10
Human Description:
leucine rich repeat containing 10 [Source:HGNC Symbol;Acc:20264]
Mouse Orthologue:
Lrrc10
Mouse Description:
leucine rich repeat containing 10 Gene [Source:MGI Symbol;Acc:MGI:2448063]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24700 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067073 Nonsense 88 269 2 2
Genomic Location:
Chromosome 25 (position 29539837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCAACCTGCAGAAGCTCCAACTTCTAGCGTTGGACTTCAACTGTTTC[G/T]AGGAGCTTCCTCTGGTCATATGCAGCCTCGTTCAGCTGAACATCCTCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v28fad05