alkbh3

Ensembl ID:
ENSDARG00000045606
ZFIN ID:
ZDB-GENE-040801-254
Description:
alkB, alkylation repair homolog 3 [Source:RefSeq peptide;Acc:NP_001003511]
Human Orthologue:
ALKBH3
Human Description:
alkB, alkylation repair homolog 3 (E. coli) [Source:HGNC Symbol;Acc:30141]
Mouse Orthologue:
Alkbh3
Mouse Description:
alkB, alkylation repair homolog 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1916363]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16257 Essential Splice Site Available for shipment Available now
sa25232 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067057 Essential Splice Site 26 282 3 10
ENSDART00000123220 Essential Splice Site 26 282 2 9
ENSDART00000145924 Essential Splice Site 26 181 3 8
ENSDART00000147327 Essential Splice Site 26 115 4 7
ENSDART00000148250 Essential Splice Site 26 91 4 7
Genomic Location:
Chromosome 25 (position 31230288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTAGAAAAAAAGGTRAATTGAATTGAAYTGAATATATTTGCGTTCTTTCA[G/A]YTCAAGATGTCCANNNNNNATCAGCATCAGGATCATGGAAATCTGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067057 Nonsense 69 282 5 10
ENSDART00000123220 Nonsense 69 282 4 9
ENSDART00000145924 Nonsense 69 181 5 8
ENSDART00000147327 Nonsense 69 115 6 7
ENSDART00000148250 Nonsense 69 91 6 7
Genomic Location:
Chromosome 25 (position 31230583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATCCAGCGTGTTGTTTTTCTTCTCTTTCTCAGAAATGCTGGTGACTA[T/A]GAGATTAGTCAGGGGCCTTCTGGAGTATCCCGGTAAGAATAATGAATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8nd16hpp