ticrr

Ensembl ID:
ENSDARG00000045605
ZFIN ID:
ZDB-GENE-040728-1
Description:
Treslin [Source:UniProtKB/Swiss-Prot;Acc:Q6DRL4]
Human Orthologue:
C15orf42
Human Description:
chromosome 15 open reading frame 42 [Source:HGNC Symbol;Acc:28704]
Mouse Orthologue:
5730590G19Rik
Mouse Description:
RIKEN cDNA 5730590G19 gene Gene [Source:MGI Symbol;Acc:MGI:1924261]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa440 Nonsense Confirmed mutation in F2 line During 2014
sa8433 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa440
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067056 Nonsense 253 1823 2 23
Genomic Location:
Chromosome 25 (position 31308426)
KASP Assay ID:
554-0292.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACACTGGCATAGAGACTCTGATGGAACGTCTTGGGCTGGTTGGTGGA[C/T]AGGTGGTGCCAATGTTGTCTCCTTGTTTACCACTGATGGACCAGCATCCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
integument
ZFA:0000368
detached from
PATO:0001453
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067056 Nonsense 1303 1823 21 23
Genomic Location:
Chromosome 25 (position 31321001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAATCCGGGTCCTTTCCTTTTTGCAATTCTCYATTGAAACCAAATATA[C/T]AAAAAACAATACAAAGCCCCATCCYAACACACAGAATGTGCACTCGCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rj3ea35d