cax1

Ensembl ID:: ENSDARG00000045601
ZFIN ID:: ZDB-GENE-030131-3044
Description:: cation/H+ exchanger protein 1 [Source:RefSeq peptide;Acc:NP_001020678]

Alleles

There are 4 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa10712	Nonsense	Available for shipment	Available now
sa2185	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa1143	Nonsense	Available for shipment	Available now
sa9985	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa10712
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000067046	Nonsense	174	764	5	20

Genomic Location:: Chromosome 4 (position 14049607)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TATAGTATATGTGTTGCTATTTGGGTGGTGGATCTCCTTGTTTTATTTTT[T/A]GGTTGGTTTGCTGATGTTTTTCACCATYGCTGGCATCCCATATGGTAAGT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa2185
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000067046	Essential Splice Site	268	764	7	20

Genomic Location:: Chromosome 4 (position 14050172)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CTGCTGAAATCCCTGTGCCTGCACCACCCACCAAGCCCACACGTTACTGG[G/A]TGAGATTTAAGCGATCTTTTCTTTAAACTTATTTWGTCTAATTCACTTAA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa1143
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000067046	Nonsense	452	764	11	20

Genomic Location:

Chromosome 4 (position 14052081)

KASP Assay ID:

554-1054.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TTCTACATCACAGCTTTACTCCAGGGTCAGCGTGCGGGATCCCAGTGTTA[T/A]GCAGAACTTGTCAAATCTGCTCTYACAGGCACCCTGCTGGGCTGTATCCT

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

Mutation Details

Allele Name:: sa9985
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000067046	Essential Splice Site	678	764	18	20

Genomic Location:: Chromosome 4 (position 14055026)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TATATATGATCTGTATGTTCCTCTGATTGCATTTTACTGTCAATCRTTCA[G/A]TCTGGAGGTGGGGAGTTGTTTAGCAGTTCAGGTGTGCATGCTGCAGATCC
Associated Phenotype:: Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: