
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cax1
- Ensembl ID:
- ENSDARG00000045601
- ZFIN ID:
- ZDB-GENE-030131-3044
- Description:
- cation/H+ exchanger protein 1 [Source:RefSeq peptide;Acc:NP_001020678]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40258 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa10712 | Nonsense | Available for shipment | Available now |
sa40259 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1143 | Nonsense | Available for shipment | Available now |
sa9985 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa40258
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067046 | Essential Splice Site | 24 | 764 | 1 | 20 |
- Genomic Location (Zv9):
- Chromosome 4 (position 14047358)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14983211 GRCz11 4 14981966 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTCCGTTGATGTGGAGAGTCGGAGGCGACGGTCCACCGAGAGCTCAGG[T/G]CAGTATTATAATCATCTTTACTTGTTAAGAATCTCCAACCGTTTTAATGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10712
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067046 | Nonsense | 174 | 764 | 5 | 20 |
- Genomic Location (Zv9):
- Chromosome 4 (position 14049607)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14985460 GRCz11 4 14984215 - KASP Assay ID:
- 2259-4734.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATAGTATATGTGTTGCTATTTGGGTGGTGGATCTCCTTGTTTTATTTTT[T/A]GGTTGGTTTGCTGATGTTTTTCACCATYGCTGGCATCCCATATGGTAAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40259
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067046 | Nonsense | 194 | 764 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 4 (position 14049756)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14985609 GRCz11 4 14984364 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTCTCACTGAAATCTGCCTTTTTGGTTTGTTTTAGGAAAGCTTTGTTTG[C/T]AGCTGTCAGGGTATTTCATATGGCCATTTGGAAAAGCATTGCAGAAAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1143
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067046 | Nonsense | 452 | 764 | 11 | 20 |
- Genomic Location (Zv9):
- Chromosome 4 (position 14052081)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14987934 GRCz11 4 14986689 - KASP Assay ID:
- 554-1054.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCTACATCACAGCTTTACTCCAGGGTCAGCGTGCGGGATCCCAGTGTTA[T/A]GCAGAACTTGTCAAATCTGCTCTYACAGGCACCCTGCTGGGCTGTATCCT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa9985
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000067046 | Essential Splice Site | 678 | 764 | 18 | 20 |
- Genomic Location (Zv9):
- Chromosome 4 (position 14055026)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14990879 GRCz11 4 14989634 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATATATGATCTGTATGTTCCTCTGATTGCATTTTACTGTCAATCRTTCA[G/A]TCTGGAGGTGGGGAGTTGTTTAGCAGTTCAGGTGTGCATGCTGCAGATCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: