cax1

Ensembl ID:
ENSDARG00000045601
ZFIN ID:
ZDB-GENE-030131-3044
Description:
cation/H+ exchanger protein 1 [Source:RefSeq peptide;Acc:NP_001020678]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10712 Nonsense Available for shipment Available now
sa2185 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1143 Nonsense Available for shipment Available now
sa9985 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Nonsense 174 764 5 20
Genomic Location:
Chromosome 4 (position 14049607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGTATATGTGTTGCTATTTGGGTGGTGGATCTCCTTGTTTTATTTTT[T/A]GGTTGGTTTGCTGATGTTTTTCACCATYGCTGGCATCCCATATGGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Essential Splice Site 268 764 7 20
Genomic Location:
Chromosome 4 (position 14050172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGAAATCCCTGTGCCTGCACCACCCACCAAGCCCACACGTTACTGG[G/A]TGAGATTTAAGCGATCTTTTCTTTAAACTTATTTWGTCTAATTCACTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Nonsense 452 764 11 20
Genomic Location:
Chromosome 4 (position 14052081)
KASP Assay ID:
554-1054.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTACATCACAGCTTTACTCCAGGGTCAGCGTGCGGGATCCCAGTGTTA[T/A]GCAGAACTTGTCAAATCTGCTCTYACAGGCACCCTGCTGGGCTGTATCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Essential Splice Site 678 764 18 20
Genomic Location:
Chromosome 4 (position 14055026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATATGATCTGTATGTTCCTCTGATTGCATTTTACTGTCAATCRTTCA[G/A]TCTGGAGGTGGGGAGTTGTTTAGCAGTTCAGGTGTGCATGCTGCAGATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qg7d1cep