si:dkey-14k9.3

Ensembl ID:
ENSDARG00000045595
ZFIN ID:
ZDB-GENE-030131-2893
Description:
hypothetical protein LOC324173 [Source:RefSeq peptide;Acc:NP_001034152]
Human Orthologue:
ZNF697
Human Description:
zinc finger protein 697 [Source:HGNC Symbol;Acc:32034]
Mouse Orthologue:
Zfp697
Mouse Description:
zinc finger protein 697 Gene [Source:MGI Symbol;Acc:MGI:2139736]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15386 Nonsense Available for shipment Available now
sa40257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067036 Nonsense 217 471 3 3
ENSDART00000137829 Nonsense 177 431 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13961665)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14897518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCAGTCAAGCGGCTCTTAAAAGACACAAGCAAATCCACGAAGAGAAG[C/T]AATCCTATAATTGCTCCAAATGCAAGTCCACCTTCATCTGCYCGACCTCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067036 Nonsense 413 471 3 3
ENSDART00000137829 Nonsense 373 431 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13961077)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14896930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTCCACATGAGGCAGCACACCGGCGTACGGCCCTATTCCTGTTCC[C/T]AATGCGACAAGAGTTTCTACAGTTCGTCCCATCTCAAGAGGCACCTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link