kcnj8

Ensembl ID:
ENSDARG00000045589
ZFIN ID:
ZDB-GENE-060308-1
Description:
ATP-sensitive inward rectifier potassium channel 8 [Source:RefSeq peptide;Acc:NP_001025324]
Human Orthologue:
KCNJ8
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 8 [Source:HGNC Symbol;Acc:6269]
Mouse Orthologue:
Kcnj8
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 8 Gene [Source:MGI Symbol;Acc:MGI:1100508

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38432 Nonsense Mutation detected in F1 DNA During 2017
sa33428 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067031 Nonsense 187 416 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13784554)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14720407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGAAGACCGCTCAATCCCACCGGCGTGCCGAAACCCTTATCTTTAGC[C/T]GACACGCAGTCATCGCTGTGCGCAACAACCGCCTCTGCTTTATGATCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067031 Nonsense 278 416 2 2
Genomic Location (Zv9):
Chromosome 4 (position 13784827)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14720680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCATTGATAAAGACAGTCCTCTGTACGATCTGTCGGCGATGGAGCTG[C/T]AGTGCAGTGATCTGGAGGTCATCGTGATCCTGGAAGGAGTGGTGGAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link