lrmp

Ensembl ID:
ENSDARG00000045574
ZFIN ID:
ZDB-GENE-041210-152
Description:
Novel protein similar to vertebrate lymphoid-restricted membrane protein (LRMP) [Source:UniProtKB/Tr
Human Orthologue:
LRMP
Human Description:
lymphoid-restricted membrane protein [Source:HGNC Symbol;Acc:6690]
Mouse Orthologue:
Lrmp
Mouse Description:
lymphoid-restricted membrane protein Gene [Source:MGI Symbol;Acc:MGI:108424]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2146 Nonsense F2 line generated During 2014
sa20251 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14727 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2146
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067007 Nonsense 125 1447 1 36
ENSDART00000131973 None None 217 None 6
ENSDART00000135730 Nonsense 125 1447 2 37
ENSDART00000147853 None None 271 None 9

The following transcripts of ENSDARG00000045574 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 16346058)
KASP Assay ID:
554-2505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGGGGACATTAGGCACAATTGGAGACAGGAGAACATCAGGAACCTA[C/A]AGCAGACCATTTCGGCGKAACTGCTCCACCCCATCGGCCCARACTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067007 Essential Splice Site 501 1447 10 36
ENSDART00000131973 None None 217 None 6
ENSDART00000135730 Essential Splice Site 501 1447 11 37
ENSDART00000147853 None None 271 None 9

The following transcripts of ENSDARG00000045574 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 16340040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTCATTTGATGCCATTCTGGCTGATAAGGAGTCATTAATTCAGGAG[G/A]TCAGTTATTGCGTATCACTAAAAGAATGATCAAAATAATATCCATGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067007 Nonsense 608 1447 14 36
ENSDART00000131973 None None 217 None 6
ENSDART00000135730 Nonsense 608 1447 15 37
ENSDART00000147853 None None 271 None 9

The following transcripts of ENSDARG00000045574 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 16338200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCTAGATCGTGAGGTTCTTCTGCTTCTTCAAGGCCCTACTCCAGAG[C/T]AGCTGTCWCTGGAGTTTAAATCTCTGATCAGCAGATTGGTAACTAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3skmbqtg