phpt1

Ensembl ID:
ENSDARG00000045567
ZFIN ID:
ZDB-GENE-040801-85
Description:
14 kDa phosphohistidine phosphatase [Source:RefSeq peptide;Acc:NP_001003566]
Human Orthologue:
PHPT1
Human Description:
phosphohistidine phosphatase 1 [Source:HGNC Symbol;Acc:30033]
Mouse Orthologue:
Phpt1
Mouse Description:
phosphohistidine phosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:1922704]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23890 Essential Splice Site Available for shipment Available now
sa13227 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067004 Essential Splice Site 49 121 1 3
ENSDART00000130436   None 108 None 2
ENSDART00000134278 Essential Splice Site 49 146 1 4
ENSDART00000143100   None 96 None 4
ENSDART00000067004 Essential Splice Site 49 121 None 3
ENSDART00000130436   None 108 None 2
ENSDART00000134278 Essential Splice Site 49 146 None 4
ENSDART00000143100   None 96 None 4
Genomic Location (Zv9):
Chromosome 21 (position 13017838)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14719012
KASP Assay ID:
2261-5395.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCATATGTTGATATAGTGAGAGGATACGCGTGGGCCGAATATCACGG[T/C]AAGATCCATTCATGTGTATGAGCCATGAATTACAGCTGATAGATAACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067004   None 121 None 3
ENSDART00000130436 Nonsense 4 108 1 2
ENSDART00000134278   None 146 None 4
ENSDART00000143100 Missense 39 96 3 4
Genomic Location (Zv9):
Chromosome 21 (position 13009262)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14710436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTGACACATTTTNCCWGTTGTCTTTTGGGGGTTGAATGGAAGGTTA[T/A]YTTGGGCCAAASTTTGTGTGTGATTTTGAGCATGAGGGCAAATGTGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link