ccdc53

Ensembl ID:
ENSDARG00000045563
ZFIN ID:
ZDB-GENE-040426-783
Description:
WASH complex subunit CCDC53 [Source:UniProtKB/Swiss-Prot;Acc:Q5RGJ6]
Human Orthologue:
CCDC53
Human Description:
coiled-coil domain containing 53 [Source:HGNC Symbol;Acc:24256]
Mouse Orthologue:
Ccdc53
Mouse Description:
coiled-coil domain containing 53 Gene [Source:MGI Symbol;Acc:MGI:1914532]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6938 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066999 Essential Splice Site 109 200 4 7
Genomic Location:
Chromosome 4 (position 16725795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGGCCCCGCAGCAGATACCAGTCGTGCCACTGCTCCCCCTGCTGAGG[T/A]AACCTTTCACAGTATTATAAYAATAATAATATCATGATCCCATTTYAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/12z77yl1