dram1

Ensembl ID:
ENSDARG00000045561
ZFIN ID:
ZDB-GENE-041010-147
Description:
DNA damage-regulated autophagy modulator protein 1 [Source:RefSeq peptide;Acc:NP_001006049]
Human Orthologue:
DRAM1
Human Description:
DNA-damage regulated autophagy modulator 1 [Source:HGNC Symbol;Acc:25645]
Mouse Orthologue:
Dram1
Mouse Description:
DNA-damage regulated autophagy modulator 1 Gene [Source:MGI Symbol;Acc:MGI:1918962]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20252 Essential Splice Site Available for shipment Available now
sa40268 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066997 Essential Splice Site 66 240 2 7
Genomic Location (Zv9):
Chromosome 4 (position 16735890)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17678730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGAGCTGTGTGTTTGGATTCATGTCGACAATTACGGCATTCGCAG[G/A]TATGACTAACAATCAGCTCTTTGATTTCAGTTTGATTTGATATCCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066997 Essential Splice Site 115 240 4 7
Genomic Location (Zv9):
Chromosome 4 (position 16733231)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17676071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAATAGTGATTTAATGGCACTCATGTATTGTATGCATGTTTTGTTACA[G/T]GAGACGACAGTGATGGAAGTCCATGATATCGGTGCTCTTTTATTCTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link