mybpc1

Ensembl ID:
ENSDARG00000045560
ZFIN ID:
ZDB-GENE-041114-196
Description:
myosin-binding protein C, slow-type [Source:RefSeq peptide;Acc:NP_001007323]
Human Orthologue:
MYBPC1
Human Description:
myosin binding protein C, slow type [Source:HGNC Symbol;Acc:7549]
Mouse Orthologue:
Mybpc1
Mouse Description:
myosin binding protein C, slow-type Gene [Source:MGI Symbol;Acc:MGI:1336213]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa153 Nonsense Available for shipment Available now
sa20253 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8977 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024775 Nonsense 43 1169 5 29
ENSDART00000066996 Nonsense 43 1168 5 31
ENSDART00000134080 Nonsense 43 1147 5 29
ENSDART00000141680 None None 105 None 3

The following transcripts of ENSDARG00000045560 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 16836209)
KASP Assay ID:
554-0015.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAGAATGTATGAGTGTGATGAGTGTGTTCTTTCTAATTGGTCAGTGT[G/A]GTCTCTTGGGGACGGACAACCTCCTGAGGAAATCGACAAACAGACTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024775 Essential Splice Site 832 1169 23 29
ENSDART00000066996 Essential Splice Site 831 1168 25 31
ENSDART00000134080 Essential Splice Site 825 1147 23 29
ENSDART00000141680 None None 105 None 3

The following transcripts of ENSDARG00000045560 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 16810958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGATAGAGGTTAAAGGGAAGTTGCTGTAATGCCCTTGTTTGTTTGCC[A/T]GAGCCTCCTAAGATTCGCATACCTCGACACTTGAAGCAGACGTACATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024775 Nonsense 848 1169 23 29
ENSDART00000066996 Nonsense 847 1168 25 31
ENSDART00000134080 Nonsense 841 1147 23 29
ENSDART00000141680 None None 105 None 3

The following transcripts of ENSDARG00000045560 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 16810909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCCWCCTAAGATTCGCATACCTCGACACTTGAAGCAGACGTACATT[C/T]GAAAGGTTGGCGAAGTTGTCAACCTCGTTGTGCCATTTGTGGTGAGGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fsk2nvjh