OTUD7A

Ensembl ID:
ENSDARG00000045556
Description:
OTU domain containing 7A [Source:HGNC Symbol;Acc:20718]
Human Orthologue:
OTUD7A
Human Description:
OTU domain containing 7A [Source:HGNC Symbol;Acc:20718]
Mouse Orthologue:
Otud7a
Mouse Description:
OTU domain containing 7A Gene [Source:MGI Symbol;Acc:MGI:2158505]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24721 Nonsense Mutation detected in F1 DNA During 2014
sa18655 Nonsense Available for shipment Available now
sa24722 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 46 933 2 15
Genomic Location:
Chromosome 25 (position 35591255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCCTGTCAGACTTTGTTCGGTCCACAGGGGCAGAACCGGGTCTGGCA[C/T]GAGACCTGCTGGAAGGTAAGAGAGACCCCATCGGGACTTTGTTTCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 569 933 14 15
Genomic Location:
Chromosome 25 (position 35640732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACGGTGGAGAACGSAGAGCAGAAATCCAAGAAAAAGGACTCGAAAACA[C/T]GRAAAGGAAGCAAAGAGGAGTCAGGCCAGTCGGCCAGYACGTCCTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 573 933 14 15
Genomic Location:
Chromosome 25 (position 35640744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGCAGAAATCCAAGAAAAAGGACTCGAAAACACGAAAAGGAAGC[A/T]AAGAGGAGTCAGGCCAGTCGGCCAGCACGTCCTCCTCAGAGAAGGCAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0x49aeoh