sco2

Ensembl ID:
ENSDARG00000045555
ZFIN ID:
ZDB-GENE-041210-173
Description:
Protein SCO2 homolog, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q5RH02]
Human Orthologue:
SCO2
Human Description:
SCO cytochrome oxidase deficient homolog 2 (yeast) [Source:HGNC Symbol;Acc:10604]
Mouse Orthologue:
Sco2
Mouse Description:
SCO cytochrome oxidase deficient homolog 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:3818630]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40273 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066988 Nonsense 107 279 1 1
Genomic Location (Zv9):
Chromosome 4 (position 17522454)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18465294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATCAGGAGAAAGAAAAGAGGATTCAGATGCAAAGACTGGAGCAGTTG[C/T]GAAAAGTGGCTCTCGGACAGGGAGATTTCCATTTGCTTGATCATACGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link