hgfa

Ensembl ID:
ENSDARG00000045544
ZFIN ID:
ZDB-GENE-041014-2
Description:
hepatocyte growth factor [Source:RefSeq peptide;Acc:NP_001013292]
Human Orthologue:
HGF
Human Description:
hepatocyte growth factor (hepapoietin A; scatter factor) [Source:HGNC Symbol;Acc:4893]
Mouse Orthologue:
Hgf
Mouse Description:
hepatocyte growth factor Gene [Source:MGI Symbol;Acc:MGI:96079]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10507 Nonsense Available for shipment Available now
sa10071 Essential Splice Site Available for shipment Available now
sa20261 Essential Splice Site Available for shipment Available now
sa38437 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066964 Nonsense 218 712 6 18
ENSDART00000100952 Nonsense 218 699 6 17
Genomic Location (Zv9):
Chromosome 4 (position 18663667)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19740273
KASP Assay ID:
2259-4850.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAACCTACAGAGGGCCYATGGATCATACAGAGAGTGGGAAAGAGTGC[C/T]AGAGATGGGACTCRCAGAAACCTCATAAACACACCTACCAGCCKCACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066964 Essential Splice Site 234 712 6 18
ENSDART00000100952 Essential Splice Site 234 699 6 17
Genomic Location (Zv9):
Chromosome 4 (position 18663616)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19740222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATGGGACTCRCAGAAACCTCATAAACACACCTACCAGCCKCACAGG[T/C]ACACATTCACAARTACATACATACANNNNTACATACANNNNMACAAACATATGTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066964 Essential Splice Site 498 712 13 18
ENSDART00000100952 Essential Splice Site 487 699 12 17
Genomic Location (Zv9):
Chromosome 4 (position 18653887)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19730493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGCAGCGGGCAGAGGATGGAAGTTGGGTGGTCAGCATTCAGAAAGGG[T/A]AAATACATAATCAACATATACGGCAAACAATGGTAACATCAAAACTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066964 Essential Splice Site 569 712 15 18
ENSDART00000100952 Essential Splice Site 558 699 14 17
Genomic Location (Zv9):
Chromosome 4 (position 18648466)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19725072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCTGCGGGCCCGAGGGATCCAACTTGGCCCTGCTCAAACTCACAACG[T/G]AAGTGCGATTATCCATCTGCCCATTCATCTTCTCATCCAGCCAGCCATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link