gcc1

Ensembl ID:
ENSDARG00000045541
ZFIN ID:
ZDB-GENE-040801-118
Description:
GRIP and coiled-coil domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001003599]
Human Orthologue:
GCC1
Human Description:
GRIP and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:19095]
Mouse Orthologue:
Gcc1
Mouse Description:
golgi coiled coil 1 Gene [Source:MGI Symbol;Acc:MGI:1921625]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40282 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024925 Nonsense 656 802 3 3
ENSDART00000121611 Nonsense 656 802 2 2
Genomic Location (Zv9):
Chromosome 4 (position 19003162)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20079768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGCACATTATCAATAGCAGTGCAGCGTTGGAAGGTGGTGACCTTGAC[G/T]AAGTTGATCCAGAGCAAGAAGAAAGCGACATCATCGCTCAAGCTCTTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link