ppp6r2

Ensembl ID:
ENSDARG00000045540
ZFIN ID:
ZDB-GENE-030131-5428
Description:
SAPS domain family like [Source:RefSeq peptide;Acc:NP_001020680]
Human Orthologue:
PPP6R2
Human Description:
protein phosphatase 6, regulatory subunit 2 [Source:HGNC Symbol;Acc:19253]
Mouse Orthologue:
Ppp6r2
Mouse Description:
protein phosphatase 6, regulatory subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1918724]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20264 Nonsense Available for shipment Available now
sa16171 Nonsense Available for shipment Available now
sa25277 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066961 Nonsense 478 878 13 24
Genomic Location (Zv9):
Chromosome 4 (position 19026980)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20103586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGAATGAAGTTTCTCTAACTTCAATCTTCAGGACTGAAGGGGGCAGA[C/T]GAAGAGGAAACATGGGTCACTTGACAAGAATCGCAAACACTGTGGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066961 Nonsense 572 878 16 24
Genomic Location (Zv9):
Chromosome 4 (position 19027725)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20104331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTAATGTAATANTTTTTGCCTTTTGTTTCAGGCATTCTCTGATTAC[C/T]AGATCCAGCAGATGAYGGCCAATTTTGTGGATCAGTTTGGTTTCAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066961 Essential Splice Site 708 878 19 24
Genomic Location (Zv9):
Chromosome 4 (position 19028482)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20105088
KASP Assay ID:
554-7652.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAGGAAGAGGCAAGTCCTCAGCAGTCTGCAGGAGCTCAGACTCAGAG[T/C]GAGTGCTATAACATTGGCCACGACTCTAAATCTATCTGCTTGCTACCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link