si:ch211-244b2.4

Ensembl ID:
ENSDARG00000045530
ZFIN ID:
ZDB-GENE-030131-8699
Description:
hypothetical protein LOC541512 [Source:RefSeq peptide;Acc:NP_001014347]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13175 Nonsense Available for shipment Available now
sa26311 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066951 Nonsense 206 363 5 10
Genomic Location (Zv9):
Chromosome 4 (position 25189487)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26113156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACAGAATGGCTGTGGTATTACAGAGGAAACCACTGTTGGTATCGTTA[T/A]GGCGACAAGGTGAGTTTTAGCAGTCATTTACGCAACACCGTTTGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066951 Essential Splice Site 209 363 5 10
Genomic Location (Zv9):
Chromosome 4 (position 25189476)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26113145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTGGTATTACAGAGGAAACCACTGTTGGTATCGTTATGGCGACAAGG[T/C]GAGTTTTAGCAGTCATTTACGCAACACCGTTTGCAAATGTAAACAAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link