fgd6

Ensembl ID:
ENSDARG00000045528
ZFIN ID:
ZDB-GENE-041210-200
Description:
FYVE, RhoGEF and PH domain-containing protein 6 [Source:RefSeq peptide;Acc:NP_001093450]
Human Orthologue:
FGD6
Human Description:
FYVE, RhoGEF and PH domain containing 6 [Source:HGNC Symbol;Acc:21740]
Mouse Orthologue:
Fgd6
Mouse Description:
FYVE, RhoGEF and PH domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1261419]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33478 Nonsense Mutation detected in F1 DNA During 2017
sa33477 Nonsense Mutation detected in F1 DNA During 2017
sa33476 Nonsense Mutation detected in F1 DNA During 2017
sa40307 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066949 Nonsense 942 1315 9 21
Genomic Location (Zv9):
Chromosome 4 (position 24966015)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25889684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATTATTTAAAAAATCTTCCTGAGGATTCTTCCGACTACAAAGACACA[C/T]AAAGTAAGAGCACATCATTAATAAAATAACCAGAGACCAGTGAAAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066949 Nonsense 1151 1315 17 21
Genomic Location (Zv9):
Chromosome 4 (position 24959781)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25883450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGATAAGAGATTTGTTTACTTTGGCCACAGGTGGTGTGTCAGGCATG[T/A]TCGTCTAATAAATTCTACCTGGAATACCTGAAGAATCAACTGGCAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066949 Nonsense 1200 1315 18 21
Genomic Location (Zv9):
Chromosome 4 (position 24955462)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25879131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGTGACCTTTTCCCCTAGTGGGCGGGGCTCAACATTCGCTTTTTCT[A/T]GAAAACAGAAGAAGATTCCATCAGCTCTCAAGGAGGTAATCTAAAGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066949 Essential Splice Site 1211 1315 18 21
Genomic Location (Zv9):
Chromosome 4 (position 24955426)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25879095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCGCTTTTTCTAGAAAACAGAAGAAGATTCCATCAGCTCTCAAGGAG[G/A]TAATCTAAAGTTAAACAATACTTAAAGGGATAGTTCACCCAAATGTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link