tmcc3

Ensembl ID:
ENSDARG00000045525
ZFIN ID:
ZDB-GENE-030131-1811
Description:
transmembrane and coiled-coil domains protein 3 [Source:RefSeq peptide;Acc:NP_001038278]
Human Orthologue:
TMCC3
Human Description:
transmembrane and coiled-coil domain family 3 [Source:HGNC Symbol;Acc:29199]
Mouse Orthologue:
Tmcc3
Mouse Description:
transmembrane and coiled coil domains 3 Gene [Source:MGI Symbol;Acc:MGI:2442900]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13798 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066946 Nonsense 203 456 2 4
ENSDART00000122881 Nonsense 223 476 2 4
ENSDART00000146658 None None 95 None 3
Genomic Location:
Chromosome 4 (position 24846425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGACAACATCGCYCACCTGAAAAGCTCAATGGAGACTGGGTCTGGGT[T/A]GCAGGCGGARGCRGGAGCCCGGATTTTRAGYGGCAGCGCCACAYTGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i80h9ljm