tmcc3

Ensembl ID:
ENSDARG00000045525
ZFIN ID:
ZDB-GENE-030131-1811
Description:
transmembrane and coiled-coil domains protein 3 [Source:RefSeq peptide;Acc:NP_001038278]
Human Orthologue:
TMCC3
Human Description:
transmembrane and coiled-coil domain family 3 [Source:HGNC Symbol;Acc:29199]
Mouse Orthologue:
Tmcc3
Mouse Description:
transmembrane and coiled coil domains 3 Gene [Source:MGI Symbol;Acc:MGI:2442900]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13798 Nonsense Available for shipment Available now
sa33475 Nonsense Mutation detected in F1 DNA During 2016
sa26307 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066946 Nonsense 203 456 2 4
ENSDART00000122881 Nonsense 223 476 2 4
ENSDART00000146658   None 95 None 3
Genomic Location:
Chromosome 4 (position 24846425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGACAACATCGCYCACCTGAAAAGCTCAATGGAGACTGGGTCTGGGT[T/A]GCAGGCGGARGCRGGAGCCCGGATTTTRAGYGGCAGCGCCACAYTGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066946 Nonsense 212 456 2 4
ENSDART00000122881 Nonsense 232 476 2 4
ENSDART00000146658   None 95 None 3
Genomic Location:
Chromosome 4 (position 24846398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAATGGAGACTGGGTCTGGGTTGCAGGCGGAAGCGGGAGCCCGGATTT[T/G]AAGCGGCAGCGCCACATTGACCCCGAAACCTAAATATCCGAGTGATGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066946 Nonsense 349 456 3 4
ENSDART00000122881 Nonsense 369 476 3 4
ENSDART00000146658   None 95 None 3
Genomic Location:
Chromosome 4 (position 24845368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAACAGGAGCTCGCGAGCATCGAGGAGAAGATGGCCTATCAGGCTTA[T/A]GAACGAGCTCGAGATATACAGGTATAATCAAACATGCATGTTCAATAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link