lamb1b

Ensembl ID:
ENSDARG00000045524
ZFIN ID:
ZDB-GENE-041210-197
Description:
Novel protein similar to vertebrate laminin, beta family protein [Source:UniProtKB/TrEMBL;Acc:Q5RH37
Human Orthologue:
LAMB1
Human Description:
laminin, beta 1 [Source:HGNC Symbol;Acc:6486]
Mouse Orthologue:
Lamb1
Mouse Description:
laminin B1 Gene [Source:MGI Symbol;Acc:MGI:96743]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6949 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa7552 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa2150 Nonsense F2 line generated During 2014
sa15082 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
Genomic Location:
Chromosome 4 (position 24808777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCACTGTAAAAAGGGACACTATGGCCTCAGCGATGACCCGTTAGGCT[G/T]TCGGTGTATGTAAACACAAATTTACAMAAAGCAGTTGCTTTTTTAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
Genomic Location:
Chromosome 4 (position 24808777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCACTGTAAAAAGGGACACTATGGCCTCAGCGATGACCCGTTAGGCT[G/T]TCGGTGTATGTAAACACAAATTTACAMAAAGCAGTTGCTTTTTTAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2150
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Nonsense 629 1767 15 33
ENSDART00000141133 Nonsense 615 1714 14 32
Genomic Location:
Chromosome 4 (position 24813232)
KASP Assay ID:
554-2568.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGTTGCCAGATGAATGGGAGCAGGTTATAGTAAAGTTGGAGCGGCCC[A/T]GAGACATTGATCAGTCAACACACTGCACTACTACATACGATGATGAACAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Nonsense 1334 1767 26 33
ENSDART00000141133 Nonsense 1318 1714 25 32
Genomic Location:
Chromosome 4 (position 24830134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTCCGTGYCARTCAAGCCATCTCTGAACCAGTCAGACAGTCTGCCT[T/A]GCTWCGAAAAGATRCAGAGGCCAARCTAGAAAGAACTGAGAATGAATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Ulcerative colitis-risk loci on chromosomes 1p36 and 12q15 found by genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/48zvvd3o