sfmbt2

Ensembl ID:
ENSDARG00000045519
ZFIN ID:
ZDB-GENE-041210-196
Description:
Novel protein similar to vertebrate Scm-like with four mbt domains 1 (SFMBT1) [Source:UniProtKB/TrEM
Human Orthologue:
SFMBT2
Human Description:
Scm-like with four mbt domains 2 [Source:HGNC Symbol;Acc:20256]
Mouse Orthologue:
Sfmbt2
Mouse Description:
Scm-like with four mbt domains 2 Gene [Source:MGI Symbol;Acc:MGI:2447794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38442 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044377 Nonsense 136 861 4 21
ENSDART00000142992 Nonsense 129 861 3 19
Genomic Location (Zv9):
Chromosome 4 (position 24418469)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25342138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTCAGCCATTAAAGAGAAGTACAGCGACTGGACTGAGTTTCTTATC[A/T]AAGAGCTCACAGGGTCACGGACAGCACCGGCAAATCTGCTGGAAGGGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link