tmem110l

Ensembl ID:
ENSDARG00000045518
ZFIN ID:
ZDB-GENE-040426-912
Description:
transmembrane protein 110, like [Source:RefSeq peptide;Acc:NP_956491]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20288 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17457 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066935 Essential Splice Site 87 282 4 9
ENSDART00000066936 Essential Splice Site 97 278 4 8
ENSDART00000142819 None None 117 None 4
ENSDART00000146792 Essential Splice Site 19 125 2 4
Genomic Location:
Chromosome 4 (position 24348932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGAGTGTATAGCTTTAACATGACATTACCTGTCTGTTTTCTGTTTGAC[A/T]GATATTTGCTGAACTTCTTGTTGGATGCCACATTGGGAATGCTTGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066935 Essential Splice Site 194 282 7 9
ENSDART00000066936 Essential Splice Site 204 278 7 8
ENSDART00000142819 Essential Splice Site 29 117 2 4
ENSDART00000146792 None None 125 None 4
Genomic Location:
Chromosome 4 (position 24343958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCCTGTAAGTATGTGGAAGTAATATAATGCCTTATGTTTGTGTTTCA[G/A]TCTATAATGTTCTGGGTKGTGGACAGTTTAAYAATGYGCAAATATAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b1ud5k5i