itih5

Ensembl ID:
ENSDARG00000045517
ZFIN ID:
ZDB-GENE-041210-193
Description:
Novel protein similar to vertebrate inter-alpha (Globulin) inhibitor H5 (ITIH5) [Source:UniProtKB/Tr
Human Orthologue:
ITIH5
Human Description:
inter-alpha (globulin) inhibitor H5 [Source:HGNC Symbol;Acc:21449]
Mouse Orthologue:
Itih5
Mouse Description:
inter-alpha (globulin) inhibitor H5 Gene [Source:MGI Symbol;Acc:MGI:1925751]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8581 Nonsense Mutation detected in F1 DNA During 2017
sa8448 Nonsense Mutation detected in F1 DNA During 2017
sa20287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356   None 200 None 7
ENSDART00000130289   None 314 None 9
ENSDART00000138121   None 906 None 11
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356   None 200 None 7
ENSDART00000130289   None 314 None 9
ENSDART00000138121   None 906 None 11
Genomic Location (Zv9):
Chromosome 4 (position 24307567)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25231236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATARATAATTATGAGATTTGAGTATTTCTTAAATTATGTATTTGGATT[C/A]ATTTTKCAGTGCTACAAGCWGNNNTTTTTTTCTATTTGCTAAATATCCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356   None 200 None 7
ENSDART00000130289   None 314 None 9
ENSDART00000138121   None 906 None 11
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356   None 200 None 7
ENSDART00000130289   None 314 None 9
ENSDART00000138121   None 906 None 11
Genomic Location (Zv9):
Chromosome 4 (position 24307567)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25231236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATARATAATTATGAGATTTGAGTATTTCTTAAATTATGTATTTGGATT[C/A]ATTTTKCAGTGCTACAAGCWGNNNTTTTTTTCTATTTGCTAAATATCCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066934 Nonsense 763 949 12 14
ENSDART00000126356   None 200 None 7
ENSDART00000130289   None 314 None 9
ENSDART00000138121 Nonsense 723 906 10 11
Genomic Location (Zv9):
Chromosome 4 (position 24329881)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25253550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTATTGTAGCAGATAAACCAAAACGCTCATACATTGAGGTGACAACA[C/T]AAAAAGTGATCTTGGACGGACGAGACCGGATGATTCTCCCCACCAGCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link