itih2

Ensembl ID:
ENSDARG00000045516
ZFIN ID:
ZDB-GENE-040426-1942
Description:
inter-alpha (globulin) inhibitor H2 [Source:RefSeq peptide;Acc:NP_998172]
Human Orthologue:
ITIH2
Human Description:
inter-alpha (globulin) inhibitor H2 [Source:HGNC Symbol;Acc:6167]
Mouse Orthologue:
Itih2
Mouse Description:
inter-alpha trypsin inhibitor, heavy chain 2 Gene [Source:MGI Symbol;Acc:MGI:96619]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26302 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066932 Nonsense 532 754 12 17
ENSDART00000066933 Nonsense 645 946 14 20
Genomic Location (Zv9):
Chromosome 4 (position 24282797)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25206466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGAAGGGAGGCCAGAACGACTGATTGCAGACTCGCCCAAAGACTCC[A/T]AACATGGCTGCTGCTCAGGTACCAGAAAGATTATCTAATGCCCGAAACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian reserve: Genetic variants and environmental factors associated with hormonal markers of ovarian reserve in Caucasian and African American women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link