kin

Ensembl ID:
ENSDARG00000045515
ZFIN ID:
ZDB-GENE-030131-3689
Description:
DNA/RNA-binding protein KIN17 [Source:RefSeq peptide;Acc:NP_001025257]
Human Orthologue:
KIN
Human Description:
KIN, antigenic determinant of recA protein homolog (mouse) [Source:HGNC Symbol;Acc:6327]
Mouse Orthologue:
Kin
Mouse Description:
antigenic determinant of rec-A protein Gene [Source:MGI Symbol;Acc:MGI:96676]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33470 Nonsense Mutation detected in F1 DNA During 2017
sa20286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078529 Nonsense 97 385 4 11
ENSDART00000136643 Nonsense 97 383 4 11
Genomic Location (Zv9):
Chromosome 4 (position 24270729)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25194398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTTCTTTCAGGGACCAAACGAGTTCACAATAACATTGTGTATAAC[G/T]AGTACATCAGTCATCGAGAACACGTTCATATGAATGCTACACAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078529 Nonsense 378 385 11 11
ENSDART00000136643 Nonsense 376 383 11 11
Genomic Location (Zv9):
Chromosome 4 (position 24274936)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25198605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGTTTTTAGGGTCGAATGAAAGGAAAGACAGTGGAGGGAATTGCATA[T/A]GAGGATTTCTCCAAACTAGCCTGATGTTCATTTTCATCTGCAGAGCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link