taf3

Ensembl ID:
ENSDARG00000045513
ZFIN ID:
ZDB-GENE-030131-6406
Description:
transcription initiation factor TFIID subunit 3 [Source:RefSeq peptide;Acc:NP_001036209]
Human Orthologue:
TAF3
Human Description:
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf3
Mouse Description:
TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14205 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066929 Nonsense 535 898 3 7
Genomic Location:
Chromosome 4 (position 24192174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGCGGGAAAAGRAGAGAGGGCAGGTGGAGGAGAACAAGATGCCCTG[G/A]CCGGAGCTATCGCTTGTAGTCGGCGGAGAAGAGCGGAGAGAYGGCATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ckzqyqs8