tbc1d22a

Ensembl ID:
ENSDARG00000045510
ZFIN IDs:
ZDB-GENE-041114-144, ZDB-GENE-041114-144
Description:
TBC1 domain family member 22A [Source:RefSeq peptide;Acc:NP_999964]
Human Orthologue:
TBC1D22A
Human Description:
TBC1 domain family, member 22A [Source:HGNC Symbol;Acc:1309]
Mouse Orthologue:
Tbc1d22a
Mouse Description:
TBC1 domain family, member 22a Gene [Source:MGI Symbol;Acc:MGI:1289265]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa856 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa856
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066924 Nonsense 513 567 13 14
ENSDART00000066925 None None 491 None 11
Genomic Location:
Chromosome 4 (position 26968918)
KASP Assay ID:
554-0759.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGGTTTCTCTCRCTTCCACTTGTATGTGTGTGCTGCCTTCTTGGTG[C/T]GATGGAGGAAAGAGATACTAGAGGAGAAAGATTTCCAGGTAAGATTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n5hfflmh