pawrl

Ensembl ID:
ENSDARG00000045486
ZFIN ID:
ZDB-GENE-041010-108
Description:
PRKC apoptosis WT1 regulator protein [Source:RefSeq peptide;Acc:NP_001006015]
Human Orthologue:
PAWR
Human Description:
PRKC, apoptosis, WT1, regulator [Source:HGNC Symbol;Acc:8614]
Mouse Orthologue:
Pawr
Mouse Description:
PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40291 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066897   None 305 None 6
ENSDART00000139962 Essential Splice Site 252 271 5 6
Genomic Location (Zv9):
Chromosome 4 (position 20274574)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 21617909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCATGAAGCTGAAGGAGGAGATCGACCTGCTGAACAGGGTGAGAAC[G/A]TGAATGTGGTTTGGTAATGGCTACATTTGACAAGCATACAGTACATGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link