rassf8b

Ensembl ID:
ENSDARG00000045485
ZFIN ID:
ZDB-GENE-040426-1338
Description:
ras association domain-containing protein 8 [Source:RefSeq peptide;Acc:NP_956657]
Human Orthologue:
RASSF8
Human Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 [Source:HGNC Symbol;Acc:13232]
Mouse Orthologue:
Rassf8
Mouse Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6944 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066895 Nonsense 9 420 2 5
ENSDART00000129765 Nonsense 9 420 1 4
Genomic Location (Zv9):
Chromosome 4 (position 19447268)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20790603
KASP Assay ID:
554-4423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGTGAGGAATGACATCATCCAGATGAGAGGCATGGAGCTGAAGGTAT[G/A]GGTGGATGGAGTGCAGCGCATTGTCTGCGGTGTCACAGAGGTCACCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link