pion

Ensembl ID:
ENSDARG00000045481
ZFIN ID:
ZDB-GENE-041210-216
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5TYU4]
Human Orthologue:
PION
Human Description:
pigeon homolog (Drosophila) [Source:HGNC Symbol;Acc:28042]
Mouse Orthologue:
Pion
Mouse Description:
pigeon homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2442259]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20267 Essential Splice Site Available for shipment Available now
sa40284 Missense, Nonsense Mutation detected in F1 DNA During 2017
sa33458 Missense, Nonsense Available for shipment Available now
sa33457 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066891 Essential Splice Site 48 872 None 32
ENSDART00000132464 Essential Splice Site 28 664 None 23
Genomic Location (Zv9):
Chromosome 4 (position 19157441)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20500776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATGTTGTGTCAAGCATTTTGGCCAAGGAGGAAAGGGCGAATATAGG[T/C]AAGCAGACTTATAGTGTAATTTAGGCTATATTAATCATCGTTTTAACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066891 Nonsense 130 872 7 32
ENSDART00000132464 Missense 80 664 5 23
Genomic Location (Zv9):
Chromosome 4 (position 19153252)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20496587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACTCCTGATATGACTCTGTTTGCTTTCTACTTTAGTGTCAAAATGTT[T/G]AACGCTTCTCATCGAGATTCACCCAATCAACAACACAAAGGTCCTAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066891 Missense 241 872 11 32
ENSDART00000132464 Nonsense 134 664 6 23
Genomic Location (Zv9):
Chromosome 4 (position 19152206)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20495541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTTTCCACACTGTAGGAGAAACACACATTGAAGTGTGTACAGTTT[T/A]ACGCCGATCGCAATTTCGAAACTGTGGTAAACTTTTTGTGCACATGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066891 Essential Splice Site 604 872 23 32
ENSDART00000132464 Essential Splice Site 429 664 15 23
Genomic Location (Zv9):
Chromosome 4 (position 19146650)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20489985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTCTCATGTGCAGAGTTTTATCCATGGTGGACACTTGGCGTTTGGG[T/A]GAGCTAAACTTACTTTAAATGGTCAGTCGTGTCAGCGAAAGGACACTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link