rala

Ensembl ID:
ENSDARG00000045463
ZFIN ID:
ZDB-GENE-040426-1344
Description:
ras-related protein Ral-A [Source:RefSeq peptide;Acc:NP_957312]
Human Orthologue:
RALA
Human Description:
v-ral simian leukemia viral oncogene homolog A (ras related) [Source:HGNC Symbol;Acc:9839]
Mouse Orthologue:
Rala
Mouse Description:
v-ral simian leukemia viral oncogene homolog A (ras related) Gene [Source:MGI Symbol;Acc:MGI:1927243

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa116 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa116
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066863 Nonsense 82 206 3 5
ENSDART00000147508 Nonsense 82 136 3 4
Genomic Location (Zv9):
Chromosome 24 (position 1031210)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1022526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTGGACACGGCCGGACAGGAGGATTACGCTGCGATTCGGGATAATTA[T/A]TTCCGCAGCGGGGAGGGATTCCTCTGCGTTTTCTCCATCACTGAACTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link