fzd8a

Ensembl ID:
ENSDARG00000045444
ZFIN ID:
ZDB-GENE-000328-3
Description:
frizzled homolog 8a [Source:RefSeq peptide;Acc:NP_570993]
Human Orthologue:
FZD8
Human Description:
frizzled homolog 8 (Drosophila) [Source:HGNC Symbol;Acc:4046]
Mouse Orthologue:
Fzd8
Mouse Description:
frizzled homolog 8 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108460]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37812 Nonsense Mutation detected in F1 DNA During 2016
sa5986 Nonsense Mutation detected in F1 DNA During 2016
sa44078 Nonsense Mutation detected in F1 DNA During 2016
sa37811 Nonsense Mutation detected in F1 DNA During 2016
sa44077 Nonsense Mutation detected in F1 DNA During 2016
sa44076 Nonsense Mutation detected in F1 DNA During 2016
sa24435 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 43 579 1 1
Genomic Location:
Chromosome 24 (position 4527516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATCACCTGTCAGGAGATCGCCGTTCCGCTGTGCAAGGGCATCGGTTA[T/G]AACTACACCTACATGCCCAACCAGTTCAACCACGACACGCAGGATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 47 579 1 1
Genomic Location:
Chromosome 24 (position 4527504)
KASP Assay ID:
554-3879.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGATCGCCGTTCCGCTGTGCAAGGGCATCGGTTATAACTACACCTA[C/A]ATGCCCAACCAGTTCAACCACGACACGCAGGATGAAGCCGGCTTGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 291 579 1 1
Genomic Location:
Chromosome 24 (position 4526774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTTCCTCTCGGCGTGCTACATGTTTGTGTCGATCGGGTATATAGTG[C/T]GATTGATCGCCGGGCACGAAAAAGTGGCGTGCAATCGGGAGTATGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 305 579 1 1
Genomic Location:
Chromosome 24 (position 4526730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTGCGATTGATCGCCGGGCACGAAAAAGTGGCGTGCAATCGGGAGTA[T/G]GACGTGGAGCACATTCACTACGAGACCACCGGCCCCGCGTTGTGCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 353 579 1 1
Genomic Location:
Chromosome 24 (position 4526587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGGGTCATCCTCTCGCTCACCTGGTTCCTCGCGGCGGGCATGAAGT[G/A]GGGAAACGAGGCCATCGCGGGCTACTCTCAGTACTTTCACCTGGCCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 353 579 1 1
Genomic Location:
Chromosome 24 (position 4526586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGGTCATCCTCTCGCTCACCTGGTTCCTCGCGGCGGGCATGAAGTG[G/A]GGAAACGAGGCCATCGCGGGCTACTCTCAGTACTTTCACCTGGCCGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 402 579 1 1
Genomic Location:
Chromosome 24 (position 4526440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGACGGAGATCCGGTCGCCGGGATCTGCTACGTTGGCAACCAGAACT[T/A]GGACAATCTGCGGGGCTTCGTGCTGGCCCCCCTGGTCATATACCTATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link