fzd8a

Ensembl ID:
ENSDARG00000045444
ZFIN ID:
ZDB-GENE-000328-3
Description:
frizzled homolog 8a [Source:RefSeq peptide;Acc:NP_570993]
Human Orthologue:
FZD8
Human Description:
frizzled homolog 8 (Drosophila) [Source:HGNC Symbol;Acc:4046]
Mouse Orthologue:
Fzd8
Mouse Description:
frizzled homolog 8 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108460]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5986 Nonsense Mutation detected in F1 DNA During 2014
sa24435 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 47 579 1 1
Genomic Location:
Chromosome 24 (position 4527504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGATCGCCGTTCCGCTGTGCAAGGGCATCGGTTATAACTACACCTA[C/A]ATGCCCAACCAGTTCAACCACGACACGCAGGATGAAGCCGGCTTGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066835 Nonsense 402 579 1 1
Genomic Location:
Chromosome 24 (position 4526440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGACGGAGATCCGGTCGCCGGGATCTGCTACGTTGGCAACCAGAACT[T/A]GGACAATCTGCGGGGCTTCGTGCTGGCCCCCCTGGTCATATACCTATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0cum5g4s