LOC100333455

Ensembl ID:
ENSDARG00000045443
Human Orthologue:
AGTR1
Human Description:
angiotensin II receptor, type 1 [Source:HGNC Symbol;Acc:336]
Mouse Orthologues:
Agtr1a, Agtr1b
Mouse Descriptions:
angiotensin II receptor, type 1a Gene [Source:MGI Symbol;Acc:MGI:87964]
angiotensin II receptor, type 1b Gene [Source:MGI Symbol;Acc:MGI:87965]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24438 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066834 Nonsense 125 359 1 1
Genomic Location:
Chromosome 24 (position 4848301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTCTACACTAGTATATTCTTCCTTACTGCTCTTAGCATTGACCGATA[T/A]CTTGCTATCGTACATCCGGTGCGCTCCCGACGCCAGCGCACACTTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nmdsj6n9