cpb1

Ensembl ID:
ENSDARG00000045442
ZFIN ID:
ZDB-GENE-030131-1132
Description:
carboxypeptidase B [Source:RefSeq peptide;Acc:NP_001103491]
Human Orthologue:
CPB1
Human Description:
carboxypeptidase B1 (tissue) [Source:HGNC Symbol;Acc:2299]
Mouse Orthologue:
Cpb1
Mouse Description:
carboxypeptidase B1 (tissue) Gene [Source:MGI Symbol;Acc:MGI:1923953]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10544 Nonsense Available for shipment Available now
sa13299 Nonsense Available for shipment Available now
sa24437 Nonsense Mutation detected in F1 DNA During 2014
sa24436 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066833 Nonsense 15 102 1 11
ENSDART00000121576 Nonsense 15 416 1 11
Genomic Location:
Chromosome 24 (position 4845342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAAAATGAAGTTATTTTTGCTCTTGGGATTGGTGGCAGTGGCTCTCTG[T/A]GAGCCAATCACATTTGTGGGGTAAATATTGATATTNNTTTTCACYATGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066833 None None 102 8 11
ENSDART00000121576 Nonsense 236 416 8 11
Genomic Location:
Chromosome 24 (position 4840366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGACAAAGAGTTTGTTTGGGTCCCCTAGGACAGAATGTGGAGAAAGACA[C/T]GATCCAAGAACAGCGGCAGCAGTTGTATCGGTACTGACCCCAAYAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066833 None None 102 8 11
ENSDART00000121576 Nonsense 257 416 8 11
Genomic Location:
Chromosome 24 (position 4840302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCAGCAGTTGTATCGGTACTGACCCCAACAGAAACTTCAATGCTGGAT[G/A]GTGCAGTGAGTACATGCTTCCTATTAAAGCTATTGTGCATATATATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066833 None None 102 9 11
ENSDART00000121576 Nonsense 313 416 9 11
Genomic Location:
Chromosome 24 (position 4838767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCCTACCTGACAGTCCACTCGTATTCCCAGCTGCTGCTCTTCCCCTA[T/G]TCCTACAAATATGACCTGGCTGCTCACCACTCAGAGCTGGTACCGCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6woirfcs