epdr1

Ensembl ID:
ENSDARG00000045420
ZFIN ID:
ZDB-GENE-040718-113
Description:
mammalian ependymin-related protein 1 [Source:RefSeq peptide;Acc:NP_001002416]
Human Orthologue:
EPDR1
Human Description:
ependymin related protein 1 (zebrafish) [Source:HGNC Symbol;Acc:17572]
Mouse Orthologue:
Epdr1
Mouse Description:
ependymin related protein 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2145369]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38339 Nonsense Mutation detected in F1 DNA During 2016
sa19796 Nonsense Available for shipment Available now
sa39860 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066788 Nonsense 59 206 1 3
Genomic Location:
Chromosome 2 (position 31552187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCGGGAGAAACACACGGGCAGCGGTCTCCTATGACGCCCAGAACCAG[A/T]GAATCAGGGTCCTGGAGCAGAAGACTGGACACACACCATGCAAGAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066788 Nonsense 109 206 2 3
Genomic Location:
Chromosome 2 (position 31553724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACAAAGCAGTGTGCAAAAATTGCTCTGACGGAGGCCTGGGATCCTTA[T/G]GATATACCCCTCAACTCCACATACGAGGACCAGTACTTTATTGGAGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066788 Nonsense 163 206 3 3
Genomic Location:
Chromosome 2 (position 31553970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTGGTGTGTACACTTTGAAAGACTGCTATCCTGTGCAGGAGACTTA[C/A]ACCAAAAACAGCAGTGTTACCACGTCCACTCGCTTCTTCGACCTTCAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link