epdr1

Ensembl ID:
ENSDARG00000045420
ZFIN ID:
ZDB-GENE-040718-113
Description:
mammalian ependymin-related protein 1 [Source:RefSeq peptide;Acc:NP_001002416]
Human Orthologue:
EPDR1
Human Description:
ependymin related protein 1 (zebrafish) [Source:HGNC Symbol;Acc:17572]
Mouse Orthologue:
Epdr1
Mouse Description:
ependymin related protein 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2145369]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066788 Nonsense 109 206 2 3
Genomic Location:
Chromosome 2 (position 31553724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACAAAGCAGTGTGCAAAAATTGCTCTGACGGAGGCCTGGGATCCTTA[T/G]GATATACCCCTCAACTCCACATACGAGGACCAGTACTTTATTGGAGGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sibvqahe