fam49bb

Ensembl ID:
ENSDARG00000045417
ZFIN ID:
ZDB-GENE-040426-2590
Description:
hypothetical protein LOC404610 [Source:RefSeq peptide;Acc:NP_996961]
Human Orthologue:
FAM49B
Human Description:
family with sequence similarity 49, member B [Source:HGNC Symbol;Acc:25216]
Mouse Orthologue:
Fam49b
Mouse Description:
family with sequence similarity 49, member B Gene [Source:MGI Symbol;Acc:MGI:1923520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6147 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066784 None None 325 None 10
ENSDART00000102484 Nonsense 54 383 1 11
ENSDART00000132282 None None 331 None 10

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 24 (position 10669484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTATACCGTGCTACCTGGACTCCATAYGTGTTTTCATCTCTTCACAAT[C/T]AAAGGTGCGTCTTCATTCCACGCTTATGTCTTTTGCATGTGCGGCGCTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a0rnlwn1