mppe1

Ensembl ID:
ENSDARG00000045416
ZFIN ID:
ZDB-GENE-050417-195
Description:
Metallophosphoesterase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q566Y9]
Human Orthologue:
MPPE1
Human Description:
metallophosphoesterase 1 [Source:HGNC Symbol;Acc:15988]
Mouse Orthologue:
Mppe1
Mouse Description:
metallophosphoesterase 1 Gene [Source:MGI Symbol;Acc:MGI:2661311]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39437 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066783 Nonsense 192 381 5 9
Genomic Location (Zv9):
Chromosome 24 (position 8792158)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 8851537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGCTGGTGAACAGTGTTGCATTACATGGTGATCATTGCCCCATCTGC[C/T]AACACGTGGAGGAGGAGTTACAGAAGCTCTCACATGCTCTTAATTGCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link