gnal

Ensembl ID:
ENSDARG00000045415
ZFIN ID:
ZDB-GENE-041114-26
Description:
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory typ
Human Orthologue:
GNAL
Human Description:
guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory typ
Mouse Orthologue:
Gnal
Mouse Description:
guanine nucleotide binding protein, alpha stimulating, olfactory type Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066782 Nonsense 300 379 10 12
ENSDART00000140924 Nonsense 300 331 10 11
Genomic Location:
Chromosome 24 (position 8766639)
KASP Assay ID:
554-1430.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAGATCCTGGCAGGAAAATCTAAACTTGAAGATTATTTTCCAGAGTA[C/A]GCTCGCTACACACYTCCCCCTGAAGGTAATGTATYGTGTATGATCATAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/14e75nyb