elovl2

Ensembl ID:
ENSDARG00000045414
ZFIN ID:
ZDB-GENE-060421-5612
Description:
elongation of very long chain fatty acids protein 2 [Source:RefSeq peptide;Acc:NP_001035452]
Human Orthologue:
ELOVL2
Human Description:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Elovl2
Mouse Description:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44089 Nonsense Mutation detected in F1 DNA During 2017
sa37827 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066781 Nonsense 141 295 5 8
Genomic Location (Zv9):
Chromosome 24 (position 8666445)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 8725824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGAATTCCTGGACACTATCTTCATTGTGCTGAGGAAGAAAAACAGC[C/T]AAATTAGTTTCCTGCATGTGTATCATCATGCCTCTATGTTTAACATCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066781 Nonsense 168 295 5 8
Genomic Location (Zv9):
Chromosome 24 (position 8666364)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 8725743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTATGTTTAACATCTGGTGGTGTGTCCTCAACTGGATACCATGTGGA[C/T]AGAGTAAGTGAGCCAGGAGGACAACATGTGTGTCAGCTATTGTATCAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link