gcm2

Ensembl ID:
ENSDARG00000045413
ZFIN ID:
ZDB-GENE-050127-1
Description:
chorion-specific transcription factor GCMb [Source:RefSeq peptide;Acc:NP_001005603]
Human Orthologue:
GCM2
Human Description:
glial cells missing homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:4198]
Mouse Orthologue:
Gcm2
Mouse Description:
glial cells missing homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1861438]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37826 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066780 Nonsense 76 496 2 5
ENSDART00000143501 Nonsense 58 478 3 6
Genomic Location (Zv9):
Chromosome 24 (position 8631338)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 8690717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGACACCTGAGCGGATGGGCCATGAGAAACACGAACAACCATAACTG[T/A]CAGATCCTGAAAAAGTCTTGTCTTGGTGTGGTGGTGTGCTCACGAAACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link