acad11

Ensembl ID:
ENSDARG00000045411
ZFIN ID:
ZDB-GENE-040426-814
Description:
acyl-CoA dehydrogenase family member 11 [Source:RefSeq peptide;Acc:NP_956472]
Human Orthologue:
ACAD11
Human Description:
acyl-CoA dehydrogenase family, member 11 [Source:HGNC Symbol;Acc:30211]
Mouse Orthologue:
Acad11
Mouse Description:
acyl-Coenzyme A dehydrogenase family, member 11 Gene [Source:MGI Symbol;Acc:MGI:2143169]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11388 Nonsense Available for shipment Available now
sa6759 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066778 Nonsense 78 769 3 20
ENSDART00000143921 Nonsense 78 277 3 7
Genomic Location:
Chromosome 24 (position 11217038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNNNNNNAAATTCATGTATTGTGTGACTTTTTTNGTTTACAGATAGATAGAGAGTA[T/A]GCTGTTCAAAAGTCTTTACATTCYGTTGGCTTTCCTGTTCCYTGYCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066778 Nonsense 642 769 17 20
ENSDART00000143921 None None 277 None 7
Genomic Location:
Chromosome 24 (position 11128971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAGGGCAGTAGGGCTGGCAGAATGTGCACTGGAGCTGCTCTGCCAT[C/T]GATCAGCCCAAAGACAAACCTTTGGAAAAAGACTGTACCAACATGTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ss03elvs