ENSDARG00000045403

Ensembl ID:
ENSDARG00000045403

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32814 Nonsense Mutation detected in F1 DNA During 2016
sa12000 Nonsense Available for shipment Available now
sa13343 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066767 Nonsense 49 289 2 5
Genomic Location:
Chromosome 2 (position 52889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAACATGTGAAGTGTTTTCTTCCTCCTCTTGTGTTTTCCAGGTGATTA[T/A]GCACAGATTGCTCTAAACTTGGACTTTCTGGAGCGAGGCCTGTATGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066767 Nonsense 216 289 4 5
Genomic Location:
Chromosome 2 (position 51371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCTGAAGCTCATCAGCGGCTCCSACACACACCGCAGCMGACAGACATC[G/T]GAGACTTCATCACTGAGGTCAAACACACACCAAACACTGATGMTGCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066767 Nonsense 269 289 5 5
Genomic Location:
Chromosome 2 (position 51054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGCTCCATCAACTCCTCCAACACAGACGGGGACCAGGATTAYGATWA[T/A]CTGAGCGACTGGGGTCCGCGGTTCCGGAAACTAGCAGACATGTACAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link