mtrr

Ensembl ID:
ENSDARG00000045398
ZFIN ID:
ZDB-GENE-101115-3
Description:
LOC560667 protein [Source:UniProtKB/TrEMBL;Acc:Q4V8W4]
Human Orthologue:
MTRR
Human Description:
5-methyltetrahydrofolate-homocysteine methyltransferase reductase [Source:HGNC Symbol;Acc:7473]
Mouse Orthologue:
Mtrr
Mouse Description:
5-methyltetrahydrofolate-homocysteine methyltransferase reductase Gene [Source:MGI Symbol;Acc:MGI:18

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10422 Nonsense Available for shipment Available now
sa24469 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8432 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Nonsense 8 713 1 15
Genomic Location:
Chromosome 24 (position 17453882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTGTGGRTTKCAGTATGTTRCAYGACCGAAGAGGCTGTTKGTGTTGT[T/A]ATTTGCAAAAGCAAGGTGACTTTTTTNNCTCTCTCCATCATTTACGTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Essential Splice Site 396 713 8 15
Genomic Location:
Chromosome 24 (position 17447003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTTATTCTCACCTGGTGTTTAGAGATAAGGAGCACTCCGAAAAAA[G/A]TAATTTTGTGTTGTTATTAACCTTATTTAATGTAATAGTTGCTGTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Nonsense 703 713 15 15
Genomic Location:
Chromosome 24 (position 17405146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCAGCTTGATAAACTRGATGCAATGAAGATAGTGGCAGGACTTCGC[G/T]AGGACAAGCGGTATCTACAGGACATCTGGAGTTGAGAAAGCACACATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lvw2j8f6