mtrr

Ensembl ID:
ENSDARG00000045398
ZFIN ID:
ZDB-GENE-101115-3
Description:
LOC560667 protein [Source:UniProtKB/TrEMBL;Acc:Q4V8W4]
Human Orthologue:
MTRR
Human Description:
5-methyltetrahydrofolate-homocysteine methyltransferase reductase [Source:HGNC Symbol;Acc:7473]
Mouse Orthologue:
Mtrr
Mouse Description:
5-methyltetrahydrofolate-homocysteine methyltransferase reductase Gene [Source:MGI Symbol;Acc:MGI:18

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10422 Nonsense Available for shipment Available now
sa24469 Essential Splice Site Available for shipment Available now
sa37856 Nonsense Mutation detected in F1 DNA During 2016
sa37855 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8432 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Nonsense 8 713 1 15
Genomic Location (Zv9):
Chromosome 24 (position 17453882)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16760358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTGTGGRTTKCAGTATGTTRCAYGACCGAAGAGGCTGTTKGTGTTGT[T/A]ATTTGCAAAAGCAAGGTGACTTTTTTNNCTCTCTCCATCATTTACGTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Essential Splice Site 396 713 8 15
Genomic Location (Zv9):
Chromosome 24 (position 17447003)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16753479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTTATTCTCACCTGGTGTTTAGAGATAAGGAGCACTCCGAAAAAA[G/A]TAATTTTGTGTTGTTATTAACCTTATTTAATGTAATAGTTGCTGTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Nonsense 572 713 12 15
Genomic Location (Zv9):
Chromosome 24 (position 17435324)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16741800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGTTGGACCTGGGACTGGTGTTGCACCTTTTATTGGATTTCTCCAA[C/T]AGAGGTACGTTCAGGAGTTTTTTTTAAACTATGCTTTTTACCCCCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Essential Splice Site 666 713 14 15
Genomic Location (Zv9):
Chromosome 24 (position 17408988)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16715464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGCCAAAATTCTCCTGGAAGACAAAGGCTGCCTTTATGTCTGTGGG[T/C]GGGTACAAAAACACATTTTTAGGCTTTGTTTAACAATCATTAGCCCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066759 Nonsense 703 713 15 15
Genomic Location (Zv9):
Chromosome 24 (position 17405146)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16711622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCAGCTTGATAAACTRGATGCAATGAAGATAGTGGCAGGACTTCGC[G/T]AGGACAAGCGGTATCTACAGGACATCTGGAGTTGAGAAAGCACACATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link