pi15a

Ensembl ID:
ENSDARG00000045378
ZFIN ID:
ZDB-GENE-040724-135
Description:
Peptidase inhibitor 15-A [Source:UniProtKB/Swiss-Prot;Acc:Q7T141]
Human Orthologue:
PI15
Human Description:
peptidase inhibitor 15 [Source:HGNC Symbol;Acc:8946]
Mouse Orthologue:
Pi15
Mouse Description:
peptidase inhibitor 15 Gene [Source:MGI Symbol;Acc:MGI:1934659]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24466 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012597 Nonsense 219 260 5 5
ENSDART00000141620 Nonsense 219 260 6 6
Genomic Location (Zv9):
Chromosome 24 (position 14714429)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14665877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGTCAATAACTGTGCTGTTGCTGTTTTTGTTTACAGGGGGAACTG[G/A]ATTGGTGAAGCCCCATATAAAGTAGGTGTTCCTTGTTCCATGTGTCCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link