prdm14

Ensembl ID:
ENSDARG00000045371
ZFIN ID:
ZDB-GENE-030131-2709
Description:
PR domain zinc finger protein 14 [Source:RefSeq peptide;Acc:NP_001157303]
Human Orthologue:
PRDM14
Human Description:
PR domain containing 14 [Source:HGNC Symbol;Acc:14001]
Mouse Orthologue:
Prdm14
Mouse Description:
PR domain containing 14 Gene [Source:MGI Symbol;Acc:MGI:3588194]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30745 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14915 Essential Splice Site Available for shipment Available now
sa24462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066720 Essential Splice Site 292 517 3 7
ENSDART00000123674 Essential Splice Site 343 568 4 8
Genomic Location (Zv9):
Chromosome 24 (position 14357505)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14308953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCCTCAAAGAGTTCATTGATGACAGTGAAGCTCTCCCGGCAGAAGG[T/C]ACGTGCACAATGCAAATTAATCACTTTTATTATTGATCATTTAACTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066720 Essential Splice Site 359 517 4 7
ENSDART00000123674 Essential Splice Site 410 568 5 8
Genomic Location (Zv9):
Chromosome 24 (position 14357814)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14309262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTCGAATTCACATTCTCCATGTGCACGAGAAACACAGGCCACATAAG[G/A]TAAATATAATACTTGGCATGATCATTTGATGGTTATGGTGCTGAAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066720 Nonsense 391 517 5 7
ENSDART00000123674 Nonsense 442 568 6 8
Genomic Location (Zv9):
Chromosome 24 (position 14358640)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14310088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACATGCGCGTGCACTCGGGAGAGCGGCCTTACAAATGTGTTTACTG[T/A]AACAAGGTGAGGTTTGCTTGGTGTTTAAACAGGTGTATTCCATTTAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link